Transcript: Mouse XM_006497588.1

PREDICTED: Mus musculus Rap guanine nucleotide exchange factor (GEF) 1 (Rapgef1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rapgef1 (107746)
Length:
6130
CDS:
279..3836

Additional Resources:

NCBI RefSeq record:
XM_006497588.1
NBCI Gene record:
Rapgef1 (107746)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306573 TCAGTGCCTTGCGCTACTTTA pLKO_005 514 CDS 100% 13.200 18.480 N Rapgef1 n/a
2 TRCN0000098094 GCCAGGAACCTTGCATGATTT pLKO.1 3098 CDS 100% 13.200 9.240 N Rapgef1 n/a
3 TRCN0000332653 GCCAGGAACCTTGCATGATTT pLKO_005 3098 CDS 100% 13.200 9.240 N Rapgef1 n/a
4 TRCN0000098091 CCAGATTATATTGACGGGAAA pLKO.1 3600 CDS 100% 4.050 2.835 N Rapgef1 n/a
5 TRCN0000098093 GCACATTGATTGACAGCTCAT pLKO.1 3475 CDS 100% 4.050 2.835 N Rapgef1 n/a
6 TRCN0000332575 GCACATTGATTGACAGCTCAT pLKO_005 3475 CDS 100% 4.050 2.835 N Rapgef1 n/a
7 TRCN0000098092 CCCAGATTATATTGACGGGAA pLKO.1 3599 CDS 100% 2.160 1.512 N Rapgef1 n/a
8 TRCN0000332576 CCCAGATTATATTGACGGGAA pLKO_005 3599 CDS 100% 2.160 1.512 N Rapgef1 n/a
9 TRCN0000098090 GCTGGCTGTGAGAACGCTCAA pLKO.1 3843 3UTR 100% 1.350 0.810 N Rapgef1 n/a
10 TRCN0000332574 GCTGGCTGTGAGAACGCTCAA pLKO_005 3843 3UTR 100% 1.350 0.810 N Rapgef1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.