Transcript: Mouse XM_006497990.2

PREDICTED: Mus musculus gelsolin (Gsn), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gsn (227753)
Length:
2716
CDS:
77..2485

Additional Resources:

NCBI RefSeq record:
XM_006497990.2
NBCI Gene record:
Gsn (227753)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071932 GACTTCTGCTAAGCGGTACAT pLKO.1 2308 CDS 100% 4.950 6.930 N Gsn n/a
2 TRCN0000324760 GACTTCTGCTAAGCGGTACAT pLKO_005 2308 CDS 100% 4.950 6.930 N Gsn n/a
3 TRCN0000071928 CGCTTTGTGATCGAAGAGGTT pLKO.1 2168 CDS 100% 2.640 2.112 N Gsn n/a
4 TRCN0000324761 CGCTTTGTGATCGAAGAGGTT pLKO_005 2168 CDS 100% 2.640 2.112 N Gsn n/a
5 TRCN0000029726 CGACAGCTACATCATTCTGTA pLKO.1 1549 CDS 100% 4.950 3.465 N GSN n/a
6 TRCN0000343402 CGACAGCTACATCATTCTGTA pLKO_005 1549 CDS 100% 4.950 3.465 N GSN n/a
7 TRCN0000071931 CTGCAGTATGACCTCCACTAT pLKO.1 458 CDS 100% 4.950 3.465 N Gsn n/a
8 TRCN0000324692 CTGCAGTATGACCTCCACTAT pLKO_005 458 CDS 100% 4.950 3.465 N Gsn n/a
9 TRCN0000071929 GCTACTTCAAGTCTGGACTTA pLKO.1 612 CDS 100% 4.950 3.465 N Gsn n/a
10 TRCN0000071930 GCTCAAGTACACGTGTCTGAA pLKO.1 902 CDS 100% 4.950 3.465 N Gsn n/a
11 TRCN0000324758 GCTCAAGTACACGTGTCTGAA pLKO_005 902 CDS 100% 4.950 3.465 N Gsn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.