Transcript: Mouse XM_006498032.2

PREDICTED: Mus musculus Ral GEF with PH domain and SH3 binding motif 1 (Ralgps1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ralgps1 (241308)
Length:
6372
CDS:
354..2111

Additional Resources:

NCBI RefSeq record:
XM_006498032.2
NBCI Gene record:
Ralgps1 (241308)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109979 CTCCGAATCATTGCCGATTTA pLKO.1 1062 CDS 100% 13.200 18.480 N Ralgps1 n/a
2 TRCN0000109977 GCAAACCTTATGTCCTTTGAA pLKO.1 2088 CDS 100% 5.625 7.875 N Ralgps1 n/a
3 TRCN0000109976 CCTCCGAATCATTGCCGATTT pLKO.1 1061 CDS 100% 10.800 7.560 N Ralgps1 n/a
4 TRCN0000150739 GCATTTGGATGATGCATGTAA pLKO.1 2045 CDS 100% 5.625 3.938 N RALGPS1 n/a
5 TRCN0000109978 CCTCCTTTACTATGGAGCCAA pLKO.1 1835 CDS 100% 2.640 1.848 N Ralgps1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.