Transcript: Mouse XM_006498124.3

PREDICTED: Mus musculus ring finger and CCCH-type zinc finger domains 2 (Rc3h2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rc3h2 (319817)
Length:
9439
CDS:
709..4272

Additional Resources:

NCBI RefSeq record:
XM_006498124.3
NBCI Gene record:
Rc3h2 (319817)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498124.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226369 CAACTCATTAGATGGATATTA pLKO_005 2913 CDS 100% 15.000 21.000 N Rc3h2 n/a
2 TRCN0000376221 CTTTAGTGACGGACCCATTAT pLKO_005 3387 CDS 100% 13.200 18.480 N Rc3h2 n/a
3 TRCN0000226370 TCGGAGCCCAAAGACGTAATT pLKO_005 3259 CDS 100% 13.200 18.480 N Rc3h2 n/a
4 TRCN0000218209 ACATCATCAGCACACTATATT pLKO_005 3577 CDS 100% 15.000 10.500 N Rc3h2 n/a
5 TRCN0000251864 ATTGGTCGTCTGAGCTATTTA pLKO_005 5807 3UTR 100% 15.000 10.500 N Rc3h2 n/a
6 TRCN0000226368 TAACTAGAGTTCCAGTATATC pLKO_005 2453 CDS 100% 13.200 9.240 N Rc3h2 n/a
7 TRCN0000376220 TGGAAGCAGGACTCCGTATTT pLKO_005 1574 CDS 100% 13.200 9.240 N Rc3h2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498124.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12056 pDONR223 100% 38.1% 38% None (many diffs) n/a
2 ccsbBroad304_12056 pLX_304 0% 38.1% 38% V5 (many diffs) n/a
3 TRCN0000479379 GTGGGCATATAACACATGTAAGCG pLX_317 20.4% 38.1% 38% V5 (many diffs) n/a
Download CSV