Transcript: Mouse XM_006498161.3

PREDICTED: Mus musculus PR domain containing 12 (Prdm12), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prdm12 (381359)
Length:
7095
CDS:
4696..5793

Additional Resources:

NCBI RefSeq record:
XM_006498161.3
NBCI Gene record:
Prdm12 (381359)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498161.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239062 CCATCTATAGAACGCAGTAAT pLKO_005 6471 3UTR 100% 13.200 18.480 N Prdm12 n/a
2 TRCN0000239063 TTCAACGAGGATGGTACAGTA pLKO_005 5113 CDS 100% 4.950 3.960 N Prdm12 n/a
3 TRCN0000367924 TTCTCCAAGACGTGGATCAAG pLKO_005 5002 CDS 100% 4.950 3.960 N PRDM12 n/a
4 TRCN0000239064 CTGCCGGTGGAAGTGATTATC pLKO_005 4945 CDS 100% 13.200 9.240 N Prdm12 n/a
5 TRCN0000239066 TCCGACATCCTGCACAGTTTC pLKO_005 4783 CDS 100% 10.800 7.560 N Prdm12 n/a
6 TRCN0000017951 CTTCTCCAAGACGTGGATCAA pLKO.1 5001 CDS 100% 4.950 3.465 N PRDM12 n/a
7 TRCN0000239065 CCGAAGCTGGATGACCTACAT pLKO_005 5166 CDS 100% 4.950 2.970 N Prdm12 n/a
8 TRCN0000017949 AGCATCTTCTACAAGGCCATT pLKO.1 5242 CDS 100% 4.050 2.835 N PRDM12 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6799 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498161.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.