Transcript: Mouse XM_006498388.3

PREDICTED: Mus musculus actin related protein 2/3 complex, subunit 5-like (Arpc5l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arpc5l (74192)
Length:
1755
CDS:
630..998

Additional Resources:

NCBI RefSeq record:
XM_006498388.3
NBCI Gene record:
Arpc5l (74192)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498388.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100312 CGCGTGGATATCGACGAATTT pLKO.1 663 CDS 100% 13.200 18.480 N Arpc5l n/a
2 TRCN0000100313 CAAACTTTAAGAGCAGCGAAA pLKO.1 793 CDS 100% 4.050 5.670 N Arpc5l n/a
3 TRCN0000446300 GGTGTAGTCCTGAAAGTACTC pLKO_005 771 CDS 100% 4.050 3.240 N Arpc5l n/a
4 TRCN0000100310 CGGTGTGTTCTCTGTATGTTA pLKO.1 1476 3UTR 100% 5.625 3.938 N Arpc5l n/a
5 TRCN0000100311 GCTCCATTATAAGAGTTCTTA pLKO.1 958 CDS 100% 5.625 3.938 N Arpc5l n/a
6 TRCN0000146953 CTTACAGCAAGAAAGACTGTT pLKO.1 975 CDS 100% 4.950 3.465 N ARPC5L n/a
7 TRCN0000100314 GAAATGGCATTGATTTGCTAA pLKO.1 841 CDS 100% 4.950 2.970 N Arpc5l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498388.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.