Transcript: Mouse XM_006498462.3

PREDICTED: Mus musculus low density lipoprotein-related protein 1B (deleted in tumors) (Lrp1b), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrp1b (94217)
Length:
16151
CDS:
714..14507

Additional Resources:

NCBI RefSeq record:
XM_006498462.3
NBCI Gene record:
Lrp1b (94217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498462.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000450049 GGACTGGGTTTCACGTAATTT pLKO_005 5774 CDS 100% 15.000 21.000 N Lrp1b n/a
2 TRCN0000119607 GCACTGATATTCACTCAATAA pLKO.1 2137 CDS 100% 13.200 18.480 N Lrp1b n/a
3 TRCN0000119609 GCACGTTTAATCCTGAAGAAA pLKO.1 3304 CDS 100% 5.625 7.875 N Lrp1b n/a
4 TRCN0000119611 CCCTACGAGAACCCAAATTAT pLKO.1 7446 CDS 100% 15.000 12.000 N Lrp1b n/a
5 TRCN0000449157 ATGTGTACAGTGGGATATTAT pLKO_005 6384 CDS 100% 15.000 10.500 N Lrp1b n/a
6 TRCN0000119610 GCAGTTGAATTGCCAGTTTAA pLKO.1 1169 CDS 100% 13.200 9.240 N Lrp1b n/a
7 TRCN0000054130 GCTGTAAAGATCAAGATGAAT pLKO.1 1261 CDS 100% 5.625 3.938 N LRP1B n/a
8 TRCN0000119608 GCCACCACTATTGTGTGAATT pLKO.1 13780 CDS 100% 0.000 0.000 N Lrp1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498462.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.