Transcript: Mouse XM_006498504.1

PREDICTED: Mus musculus hemicentin 2 (Hmcn2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hmcn2 (665700)
Length:
15236
CDS:
80..14893

Additional Resources:

NCBI RefSeq record:
XM_006498504.1
NBCI Gene record:
Hmcn2 (665700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109676 GCTGGATGAGTGTCACTACAA pLKO.1 13873 CDS 100% 4.950 6.930 N Hmcn2 n/a
2 TRCN0000109679 GAGCGTCTACATCCTGCTAAT pLKO.1 14848 CDS 100% 10.800 8.640 N Hmcn2 n/a
3 TRCN0000109678 GATGAGTGTCACTACAATCAA pLKO.1 13877 CDS 100% 5.625 3.938 N Hmcn2 n/a
4 TRCN0000109677 GAGTCATCAATGGTCAGGAAT pLKO.1 12915 CDS 100% 4.950 3.465 N Hmcn2 n/a
5 TRCN0000109675 CCCTTTGATGGCAAAGCCAAT pLKO.1 15063 3UTR 100% 0.405 0.284 N Hmcn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.