Transcript: Mouse XM_006498549.3

PREDICTED: Mus musculus adaptor-related protein complex AP-4, epsilon 1 (Ap4e1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ap4e1 (108011)
Length:
6090
CDS:
202..3372

Additional Resources:

NCBI RefSeq record:
XM_006498549.3
NBCI Gene record:
Ap4e1 (108011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254372 ACATGACCTAAGCTAATATTA pLKO_005 3583 3UTR 100% 15.000 21.000 N Ap4e1 n/a
2 TRCN0000254374 TCCATGAACTTACCATTATTA pLKO_005 3022 CDS 100% 15.000 21.000 N Ap4e1 n/a
3 TRCN0000254371 ATAGTGGCAGATGCGTCTTTA pLKO_005 1846 CDS 100% 13.200 18.480 N Ap4e1 n/a
4 TRCN0000267582 CTTACGAAGAGCCGAGTTAAA pLKO_005 906 CDS 100% 13.200 18.480 N Ap4e1 n/a
5 TRCN0000254373 CAGCCGTTCTTCCACTAATAG pLKO_005 500 CDS 100% 13.200 9.240 N Ap4e1 n/a
6 TRCN0000149437 GCTGAGAAATATGCTCCTGAT pLKO.1 1309 CDS 100% 4.050 2.835 N AP4E1 n/a
7 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 4445 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.