Transcript: Mouse XM_006498695.3

PREDICTED: Mus musculus ets homologous factor (Ehf), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ehf (13661)
Length:
4293
CDS:
17..952

Additional Resources:

NCBI RefSeq record:
XM_006498695.3
NBCI Gene record:
Ehf (13661)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498695.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231214 GGGATCGTTACCTAGTTATTA pLKO_005 2811 3UTR 100% 15.000 21.000 N Ehf n/a
2 TRCN0000081788 CCGGGCTATGAGATATTACTA pLKO.1 841 CDS 100% 5.625 7.875 N Ehf n/a
3 TRCN0000231212 AGTCCGCACACAATGTCATTG pLKO_005 417 CDS 100% 10.800 8.640 N Ehf n/a
4 TRCN0000081789 GCTGGTCTATAAGTTTGGGAA pLKO.1 898 CDS 100% 2.640 2.112 N Ehf n/a
5 TRCN0000231211 CTTTCCAGGAGTTCGACATTA pLKO_005 270 CDS 100% 13.200 9.240 N Ehf n/a
6 TRCN0000081790 CGCACACAATGTCATTGTCAA pLKO.1 421 CDS 100% 4.950 3.465 N Ehf n/a
7 TRCN0000081792 CCAGGACTGATCAAATGGGAA pLKO.1 719 CDS 100% 2.640 1.848 N Ehf n/a
8 TRCN0000081791 CATGCAATGTTTCCAGCGGTT pLKO.1 138 CDS 100% 2.160 1.512 N Ehf n/a
9 TRCN0000231213 GGAGCAAGACCACCCTGTAAA pLKO_005 616 CDS 100% 13.200 7.920 N Ehf n/a
10 TRCN0000257160 GGGAGTTCATCCGAGACATTC pLKO_005 678 CDS 100% 10.800 6.480 N Ehf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498695.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02956 pDONR223 100% 85.8% 90.3% None (many diffs) n/a
2 ccsbBroad304_02956 pLX_304 0% 85.8% 90.3% V5 (many diffs) n/a
Download CSV