Transcript: Mouse XM_006498878.3

PREDICTED: Mus musculus myeloblastosis oncogene-like 2 (Mybl2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mybl2 (17865)
Length:
3581
CDS:
496..2187

Additional Resources:

NCBI RefSeq record:
XM_006498878.3
NBCI Gene record:
Mybl2 (17865)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498878.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042510 GCTCTCGACATTATGGATGAA pLKO.1 1843 CDS 100% 4.950 6.930 N Mybl2 n/a
2 TRCN0000042508 CCAGAATCTCTCAAGCGTGAA pLKO.1 1306 CDS 100% 4.050 5.670 N Mybl2 n/a
3 TRCN0000333992 CCAGAATCTCTCAAGCGTGAA pLKO_005 1306 CDS 100% 4.050 5.670 N Mybl2 n/a
4 TRCN0000042512 TCTGCTAAAGAACTCGGACAT pLKO.1 1240 CDS 100% 4.050 5.670 N Mybl2 n/a
5 TRCN0000333991 TCTGCTAAAGAACTCGGACAT pLKO_005 1240 CDS 100% 4.050 5.670 N Mybl2 n/a
6 TRCN0000347995 AGCTCCCAAGAACTATGTATG pLKO_005 2672 3UTR 100% 10.800 7.560 N Mybl2 n/a
7 TRCN0000042511 GAGACAACAGATGTAAGGTTA pLKO.1 572 CDS 100% 4.950 3.465 N Mybl2 n/a
8 TRCN0000333990 GAGACAACAGATGTAAGGTTA pLKO_005 572 CDS 100% 4.950 3.465 N Mybl2 n/a
9 TRCN0000042509 GTCAAGAAGTATGGCACCAAA pLKO.1 787 CDS 100% 4.950 3.465 N Mybl2 n/a
10 TRCN0000020521 CCCAGATCAGAAGTACTCCAT pLKO.1 1599 CDS 100% 2.640 1.848 N MYBL2 n/a
11 TRCN0000278025 CCCAGATCAGAAGTACTCCAT pLKO_005 1599 CDS 100% 2.640 1.848 N MYBL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498878.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.