Transcript: Mouse XM_006499250.1

PREDICTED: Mus musculus Rho GTPase activating protein 1 (Arhgap1), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap1 (228359)
Length:
2929
CDS:
185..1504

Additional Resources:

NCBI RefSeq record:
XM_006499250.1
NBCI Gene record:
Arhgap1 (228359)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499250.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097234 CCCTGCTAATAGGGATGATAA pLKO.1 1929 3UTR 100% 13.200 18.480 N Arhgap1 n/a
2 TRCN0000305834 ATTGTGGAAGTAGCCGGTGAT pLKO_005 398 CDS 100% 4.050 3.240 N Arhgap1 n/a
3 TRCN0000305835 GCTTGGTTCTTCTAGGATTTA pLKO_005 1752 3UTR 100% 13.200 9.240 N Arhgap1 n/a
4 TRCN0000097238 CAAGATGACCAACACTAACTT pLKO.1 1339 CDS 100% 5.625 3.938 N Arhgap1 n/a
5 TRCN0000324650 CAAGATGACCAACACTAACTT pLKO_005 1339 CDS 100% 5.625 3.938 N Arhgap1 n/a
6 TRCN0000097236 CCTCGCCAAGTGCTCAAGTAT pLKO.1 803 CDS 100% 5.625 3.938 N Arhgap1 n/a
7 TRCN0000047299 CCCAAGTCAGATGACTCCAAA pLKO.1 308 CDS 100% 4.950 3.465 N ARHGAP1 n/a
8 TRCN0000291746 CCCAAGTCAGATGACTCCAAA pLKO_005 308 CDS 100% 4.950 3.465 N ARHGAP1 n/a
9 TRCN0000097235 CCTGAACCCTTGCTAACCTTT pLKO.1 1160 CDS 100% 4.950 3.465 N Arhgap1 n/a
10 TRCN0000324714 CCTGAACCCTTGCTAACCTTT pLKO_005 1160 CDS 100% 4.950 3.465 N Arhgap1 n/a
11 TRCN0000097237 CCTCAAGGCTATCAATCCCAT pLKO.1 1411 CDS 100% 2.640 1.848 N Arhgap1 n/a
12 TRCN0000324652 CCTCAAGGCTATCAATCCCAT pLKO_005 1411 CDS 100% 2.640 1.848 N Arhgap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499250.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.