Transcript: Mouse XM_006499363.3

PREDICTED: Mus musculus Ral GTPase activating protein, beta subunit (non-catalytic) (Ralgapb), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ralgapb (228850)
Length:
8425
CDS:
305..4816

Additional Resources:

NCBI RefSeq record:
XM_006499363.3
NBCI Gene record:
Ralgapb (228850)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499363.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267143 TCTATTCCATTACCCATTATT pLKO_005 611 CDS 100% 15.000 21.000 N Ralgapb n/a
2 TRCN0000267142 TGGTGAGGCAGACGGTAATAA pLKO_005 4629 CDS 100% 15.000 12.000 N Ralgapb n/a
3 TRCN0000151249 GCCAGCTTATTTATCCAGATT pLKO.1 1942 CDS 100% 4.950 3.960 N RALGAPB n/a
4 TRCN0000267145 GAGATTCTGCCAGCTTATTTA pLKO_005 1934 CDS 100% 15.000 10.500 N Ralgapb n/a
5 TRCN0000267146 TAGGGACTGCCTTGGATATTA pLKO_005 7708 3UTR 100% 15.000 10.500 N Ralgapb n/a
6 TRCN0000267144 TTTATCCTTAGAGGCATTAAA pLKO_005 3679 CDS 100% 15.000 10.500 N Ralgapb n/a
7 TRCN0000151551 GCAGCATTTGTTCACTGTAAA pLKO.1 1664 CDS 100% 13.200 9.240 N RALGAPB n/a
8 TRCN0000285297 GCAGCATTTGTTCACTGTAAA pLKO_005 1664 CDS 100% 13.200 9.240 N RALGAPB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499363.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.