Transcript: Mouse XM_006499424.3

PREDICTED: Mus musculus teashirt zinc finger family member 2 (Tshz2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tshz2 (228911)
Length:
9101
CDS:
3457..6609

Additional Resources:

NCBI RefSeq record:
XM_006499424.3
NBCI Gene record:
Tshz2 (228911)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499424.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098072 CGTCGGACATTTGTGAGCAAA pLKO.1 6502 CDS 100% 4.950 3.960 N Tshz2 n/a
2 TRCN0000098071 CCACCGAGTTAAAGAAAGAAA pLKO.1 4889 CDS 100% 5.625 3.938 N Tshz2 n/a
3 TRCN0000098073 CCGAGATGTTTCAGACAAGAA pLKO.1 3819 CDS 100% 4.950 3.465 N Tshz2 n/a
4 TRCN0000098074 CCAGAAACAATAGCTGGCGAA pLKO.1 6445 CDS 100% 2.160 1.512 N Tshz2 n/a
5 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 3601 CDS 100% 4.950 2.475 Y PTMA n/a
6 TRCN0000016663 CGGACATTTGTGAGCAAACAT pLKO.1 6505 CDS 100% 5.625 7.875 N TSHZ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499424.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.