Transcript: Mouse XM_006499481.3

PREDICTED: Mus musculus low density lipoprotein receptor class A domain containing 3 (Ldlrad3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ldlrad3 (241576)
Length:
3757
CDS:
81..1022

Additional Resources:

NCBI RefSeq record:
XM_006499481.3
NBCI Gene record:
Ldlrad3 (241576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499481.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119615 GCGAAAGCGAAACAACCTCAT pLKO.1 575 CDS 100% 4.050 5.670 N Ldlrad3 n/a
2 TRCN0000119614 GTCACCTACAATGTCAATAAT pLKO.1 675 CDS 100% 15.000 10.500 N Ldlrad3 n/a
3 TRCN0000119613 CGTCACCTACAATGTCAATAA pLKO.1 674 CDS 100% 13.200 9.240 N Ldlrad3 n/a
4 TRCN0000423913 AGAATAACTGTCAAGACAACA pLKO_005 388 CDS 100% 4.950 3.465 N LDLRAD3 n/a
5 TRCN0000119612 CCCTTCTAGTTAAGGGACTAT pLKO.1 2309 3UTR 100% 0.495 0.347 N Ldlrad3 n/a
6 TRCN0000153529 CCCTTCTAGTTAAGGGACTAT pLKO.1 2309 3UTR 100% 0.495 0.347 N LDLRAD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499481.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.