Transcript: Mouse XM_006499874.3

PREDICTED: Mus musculus synapse differentiation inducing 1 (Syndig1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Syndig1 (433485)
Length:
2156
CDS:
368..1144

Additional Resources:

NCBI RefSeq record:
XM_006499874.3
NBCI Gene record:
Syndig1 (433485)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270360 GTCCCACTATCGTCCCAATAT pLKO_005 619 CDS 100% 13.200 18.480 N Syndig1 n/a
2 TRCN0000281709 GCCTTACTCTGTCCACTAAAT pLKO_005 1974 3UTR 100% 13.200 10.560 N Syndig1 n/a
3 TRCN0000270322 GCAGTCCTGTCCATTACTATT pLKO_005 1055 CDS 100% 13.200 9.240 N Syndig1 n/a
4 TRCN0000281710 CTACTCCAGCGACACAGAAAG pLKO_005 853 CDS 100% 10.800 7.560 N Syndig1 n/a
5 TRCN0000284257 GGCTTAATTAACACCAGAAAC pLKO_005 437 CDS 100% 10.800 7.560 N Syndig1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08994 pDONR223 100% 87.7% 93% None (many diffs) n/a
2 ccsbBroad304_08994 pLX_304 0% 87.7% 93% V5 (many diffs) n/a
3 TRCN0000472771 ATTAAATATTACGGAAAGGTGGGA pLX_317 64.3% 87.7% 93% V5 (many diffs) n/a
Download CSV