Transcript: Mouse XM_006499902.2

PREDICTED: Mus musculus cell cycle associated protein 1 (Caprin1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Caprin1 (53872)
Length:
4100
CDS:
426..2312

Additional Resources:

NCBI RefSeq record:
XM_006499902.2
NBCI Gene record:
Caprin1 (53872)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499902.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102224 CCCTATAATTTCATACAGGAT pLKO.1 1287 CDS 100% 2.640 3.696 N Caprin1 n/a
2 TRCN0000102221 CCGCAAATGAACACTCAGCAA pLKO.1 2283 CDS 100% 2.640 3.696 N Caprin1 n/a
3 TRCN0000102222 GCCGTATCTAAGTACCAGGAA pLKO.1 465 CDS 100% 2.640 3.696 N Caprin1 n/a
4 TRCN0000312037 GCCGTATCTAAGTACCAGGAA pLKO_005 465 CDS 100% 2.640 3.696 N Caprin1 n/a
5 TRCN0000313080 TCAGTACCAGGCCACTTATAA pLKO_005 1799 CDS 100% 15.000 12.000 N Caprin1 n/a
6 TRCN0000102223 CCAATGGATTTAGAGGAGGAT pLKO.1 2068 CDS 100% 2.640 2.112 N Caprin1 n/a
7 TRCN0000313079 TTGAGTGGAGTGCCAATATTG pLKO_005 696 CDS 100% 13.200 9.240 N Caprin1 n/a
8 TRCN0000102220 GCCTGAAAGTTCTTAAAGAAA pLKO.1 3279 3UTR 100% 5.625 3.938 N Caprin1 n/a
9 TRCN0000312038 GCCTGAAAGTTCTTAAAGAAA pLKO_005 3279 3UTR 100% 5.625 3.938 N Caprin1 n/a
10 TRCN0000349857 GCAGCGTGTACAAGATCTTAT pLKO_005 1250 CDS 100% 13.200 7.920 N Caprin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499902.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.