Transcript: Mouse XM_006499998.2

PREDICTED: Mus musculus sterile alpha motif and leucine zipper containing kinase AZK (Zak), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map3k20 (65964)
Length:
3100
CDS:
968..2428

Additional Resources:

NCBI RefSeq record:
XM_006499998.2
NBCI Gene record:
Map3k20 (65964)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499998.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322253 ATGAGTGGATACGCAAGTTTG pLKO_005 1100 CDS 100% 10.800 15.120 N Map3k20 n/a
2 TRCN0000322189 CAACTAGAGGTGGCAATTAAA pLKO_005 2606 3UTR 100% 15.000 10.500 N Map3k20 n/a
3 TRCN0000322250 GAGAAGCTAACCCACGATTAT pLKO_005 1232 CDS 100% 13.200 9.240 N Map3k20 n/a
4 TRCN0000022493 CCGAAGCAGAAACAAGTACTA pLKO.1 2044 CDS 100% 4.950 3.465 N Map3k20 n/a
5 TRCN0000174204 CCGAAGCAGAAACAAGTACTA pLKO.1 2044 CDS 100% 4.950 3.465 N Map3k20 n/a
6 TRCN0000022492 CCACGATTATCTGAACCTGTT pLKO.1 1243 CDS 100% 4.050 2.835 N Map3k20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499998.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.