Transcript: Mouse XM_006500018.3

PREDICTED: Mus musculus diphthamine biosynthesis 6 (Dph6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dph6 (66632)
Length:
2729
CDS:
66..875

Additional Resources:

NCBI RefSeq record:
XM_006500018.3
NBCI Gene record:
Dph6 (66632)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500018.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251057 GACAATCAAGCTCGTTGTAAT pLKO_005 1770 3UTR 100% 13.200 18.480 N Dph6 n/a
2 TRCN0000251056 GATGAAACAGCTAACTCTATA pLKO_005 874 CDS 100% 13.200 18.480 N Dph6 n/a
3 TRCN0000251060 GGGTATCAGTAGGTGCTATAC pLKO_005 529 CDS 100% 10.800 8.640 N Dph6 n/a
4 TRCN0000251058 TCTAATATCAAGGCCATTATC pLKO_005 663 CDS 100% 13.200 9.240 N Dph6 n/a
5 TRCN0000251059 CAGATGAACTGGATAGCTATA pLKO_005 322 CDS 100% 10.800 7.560 N Dph6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500018.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04502 pDONR223 100% 63.6% 52.3% None (many diffs) n/a
2 ccsbBroad304_04502 pLX_304 0% 63.6% 52.3% V5 (many diffs) n/a
3 TRCN0000467870 GACCCTCCCGTTTGTGAAGTCACG pLX_317 42.6% 63.6% 52.3% V5 (many diffs) n/a
Download CSV