Transcript: Mouse XM_006500072.3

PREDICTED: Mus musculus cleavage stimulation factor, 3' pre-RNA, subunit 1 (Cstf1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cstf1 (67337)
Length:
3329
CDS:
204..1499

Additional Resources:

NCBI RefSeq record:
XM_006500072.3
NBCI Gene record:
Cstf1 (67337)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112012 CGGTTACATTAGTATCGCCAA pLKO.1 278 CDS 100% 2.160 3.024 N Cstf1 n/a
2 TRCN0000112014 CAACCACACTGAGGACTATAT pLKO.1 1286 CDS 100% 13.200 9.240 N Cstf1 n/a
3 TRCN0000317614 CAACCACACTGAGGACTATAT pLKO_005 1286 CDS 100% 13.200 9.240 N Cstf1 n/a
4 TRCN0000112011 GTAGCGAAACTCTGGGAGATT pLKO.1 1188 CDS 100% 4.950 3.465 N Cstf1 n/a
5 TRCN0000317613 GTAGCGAAACTCTGGGAGATT pLKO_005 1188 CDS 100% 4.950 3.465 N Cstf1 n/a
6 TRCN0000112013 GCTCCGTTAACTATAATCCTA pLKO.1 1000 CDS 100% 3.000 2.100 N Cstf1 n/a
7 TRCN0000317612 GCTCCGTTAACTATAATCCTA pLKO_005 1000 CDS 100% 3.000 2.100 N Cstf1 n/a
8 TRCN0000112010 GCCTTGGATCTGTGTGTGGAA pLKO.1 1617 3UTR 100% 2.640 1.848 N Cstf1 n/a
9 TRCN0000317615 GCCTTGGATCTGTGTGTGGAA pLKO_005 1617 3UTR 100% 2.640 1.848 N Cstf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.