Transcript: Mouse XM_006500101.2

PREDICTED: Mus musculus solute carrier family 39 (metal ion transporter), member 13 (Slc39a13), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc39a13 (68427)
Length:
2280
CDS:
185..1168

Additional Resources:

NCBI RefSeq record:
XM_006500101.2
NBCI Gene record:
Slc39a13 (68427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500101.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113086 GTCGCCTGGATAATAAAGAAA pLKO.1 321 CDS 100% 5.625 3.938 N Slc39a13 n/a
2 TRCN0000317059 GTCGCCTGGATAATAAAGAAA pLKO_005 321 CDS 100% 5.625 3.938 N Slc39a13 n/a
3 TRCN0000042844 CCTGGCGTTGGAGAAGATGTT pLKO.1 670 CDS 100% 4.950 3.465 N SLC39A13 n/a
4 TRCN0000113088 CTGCTTTCATTGTTTGTTGAA pLKO.1 1145 CDS 100% 4.950 3.465 N Slc39a13 n/a
5 TRCN0000316979 CTGCTTTCATTGTTTGTTGAA pLKO_005 1145 CDS 100% 4.950 3.465 N Slc39a13 n/a
6 TRCN0000113089 GTGTTACCTGACCTCTTGGAA pLKO.1 1058 CDS 100% 3.000 2.100 N Slc39a13 n/a
7 TRCN0000317058 GTGTTACCTGACCTCTTGGAA pLKO_005 1058 CDS 100% 3.000 2.100 N Slc39a13 n/a
8 TRCN0000113087 AGTGGCTATCTCAACCTGCTT pLKO.1 722 CDS 100% 2.640 1.848 N Slc39a13 n/a
9 TRCN0000317055 AGTGGCTATCTCAACCTGCTT pLKO_005 722 CDS 100% 2.640 1.848 N Slc39a13 n/a
10 TRCN0000113085 GCCTCACTTCTCATTGACAAA pLKO.1 1427 3UTR 100% 4.950 2.970 N Slc39a13 n/a
11 TRCN0000317057 GCCTCACTTCTCATTGACAAA pLKO_005 1427 3UTR 100% 4.950 2.970 N Slc39a13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500101.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16061 pDONR223 0% 78.2% 81.3% None (many diffs) n/a
2 ccsbBroad304_16061 pLX_304 0% 78.2% 81.3% V5 (many diffs) n/a
Download CSV