Transcript: Mouse XM_006500109.3

PREDICTED: Mus musculus smoothelin-like 1 (Smtnl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smtnl1 (68678)
Length:
3053
CDS:
723..2102

Additional Resources:

NCBI RefSeq record:
XM_006500109.3
NBCI Gene record:
Smtnl1 (68678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112941 CCCAATGAAGTTAGGGAGAAA pLKO.1 1089 CDS 100% 4.950 3.960 N Smtnl1 n/a
2 TRCN0000112944 CAGCATCTAAGAGTGGCGAAT pLKO.1 892 CDS 100% 4.050 3.240 N Smtnl1 n/a
3 TRCN0000112943 GAAGGCCATCATGGACAAATT pLKO.1 1664 CDS 100% 13.200 9.240 N Smtnl1 n/a
4 TRCN0000255558 ACCTACATCCAGGAGCTATAC pLKO_005 2037 CDS 100% 10.800 7.560 N Smtnl1 n/a
5 TRCN0000281502 GCACTGTTCCGGAACACAAAG pLKO_005 1710 CDS 100% 10.800 7.560 N Smtnl1 n/a
6 TRCN0000255559 TCAGATTGGGCAGAACATTTG pLKO_005 864 CDS 100% 10.800 7.560 N Smtnl1 n/a
7 TRCN0000112940 AGCAGGTGACACCAGTATCAA pLKO.1 2184 3UTR 100% 5.625 3.938 N Smtnl1 n/a
8 TRCN0000112942 GCACAACTTCACCCTAGCTTT pLKO.1 1925 CDS 100% 4.950 3.465 N Smtnl1 n/a
9 TRCN0000255557 GAGACCAATCTAGAATCTAAG pLKO_005 1155 CDS 100% 10.800 6.480 N Smtnl1 n/a
10 TRCN0000265656 ACGAGCACGTGGATATCCAAA pLKO_005 1801 CDS 100% 4.950 2.970 N Smtnl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.