Transcript: Mouse XM_006500148.1

PREDICTED: Mus musculus NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 (Ndufaf1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ndufaf1 (69702)
Length:
1372
CDS:
183..1175

Additional Resources:

NCBI RefSeq record:
XM_006500148.1
NBCI Gene record:
Ndufaf1 (69702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295463 GACGGCCTTGGATGGTAAATA pLKO_005 838 CDS 100% 15.000 21.000 N Ndufaf1 n/a
2 TRCN0000041848 CGCCCATTACAAGAGGTCATA pLKO.1 522 CDS 100% 4.950 6.930 N Ndufaf1 n/a
3 TRCN0000027195 GCAATTAGAGATGAAGCAATA pLKO.1 444 CDS 100% 10.800 8.640 N NDUFAF1 n/a
4 TRCN0000297979 GCAATTAGAGATGAAGCAATA pLKO_005 444 CDS 100% 10.800 8.640 N NDUFAF1 n/a
5 TRCN0000041852 CACGGAGTTTATCCAGAGAAA pLKO.1 869 CDS 100% 4.950 3.960 N Ndufaf1 n/a
6 TRCN0000287760 CACGGAGTTTATCCAGAGAAA pLKO_005 869 CDS 100% 4.950 3.960 N Ndufaf1 n/a
7 TRCN0000041849 CCCACTCGTATTGGACAAGAT pLKO.1 1007 CDS 100% 4.950 3.465 N Ndufaf1 n/a
8 TRCN0000041851 GTGTAGACTATTCTTCCAGTA pLKO.1 283 CDS 100% 4.050 2.835 N Ndufaf1 n/a
9 TRCN0000287829 GTGTAGACTATTCTTCCAGTA pLKO_005 283 CDS 100% 4.050 2.835 N Ndufaf1 n/a
10 TRCN0000041850 CCCATACAGAAGAATTTGCTT pLKO.1 1114 CDS 100% 3.000 2.100 N Ndufaf1 n/a
11 TRCN0000287831 CCCATACAGAAGAATTTGCTT pLKO_005 1114 CDS 100% 3.000 2.100 N Ndufaf1 n/a
12 TRCN0000295462 TCAGTAGAGTAGTGGTCACAA pLKO_005 1189 3UTR 100% 4.950 2.970 N Ndufaf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.