Transcript: Mouse XM_006500178.2

PREDICTED: Mus musculus fibrous sheath-interacting protein 1 (Fsip1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fsip1 (71313)
Length:
1931
CDS:
336..1733

Additional Resources:

NCBI RefSeq record:
XM_006500178.2
NBCI Gene record:
Fsip1 (71313)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196031 GCGAAACATTGAGTTGGCCAA pLKO.1 1229 CDS 100% 2.160 3.024 N Fsip1 n/a
2 TRCN0000257947 CACCATCTTCAGCCTTGAAAG pLKO_005 1466 CDS 100% 10.800 8.640 N Fsip1 n/a
3 TRCN0000249978 AGCTTGCTGAGATTGACATAA pLKO_005 1417 CDS 100% 13.200 9.240 N Fsip1 n/a
4 TRCN0000265260 CAGAGCCATAAGGGTGATATG pLKO_005 1488 CDS 100% 10.800 7.560 N Fsip1 n/a
5 TRCN0000249980 CTGGGAGCCGAAGTTCAAATG pLKO_005 496 CDS 100% 10.800 7.560 N Fsip1 n/a
6 TRCN0000249979 GGTTCCAGGAGAAGGCTATAC pLKO_005 1373 CDS 100% 10.800 7.560 N Fsip1 n/a
7 TRCN0000195963 CCACCATCTTCAGCCTTGAAA pLKO.1 1465 CDS 100% 5.625 3.938 N Fsip1 n/a
8 TRCN0000180954 GAGACGAATGCTGTACTTCAA pLKO.1 756 CDS 100% 4.950 3.465 N Fsip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.