Transcript: Mouse XM_006500335.2

PREDICTED: Mus musculus RIKEN cDNA 4932414N04 gene (4932414N04Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4932414N04Rik (75721)
Length:
3629
CDS:
152..3472

Additional Resources:

NCBI RefSeq record:
XM_006500335.2
NBCI Gene record:
4932414N04Rik (75721)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432021 CCATAATGCCTCACGCATAAA pLKO_005 3064 CDS 100% 13.200 18.480 N 4932414N04Rik n/a
2 TRCN0000103925 GCCCGCAAATCAGTCCATAAT pLKO.1 2305 CDS 100% 13.200 18.480 N 4932414N04Rik n/a
3 TRCN0000428145 CAGTTACACTACCACTATTAG pLKO_005 3452 CDS 100% 13.200 10.560 N 4932414N04Rik n/a
4 TRCN0000422991 ATTATGATTTGCCTGATTATG pLKO_005 1308 CDS 100% 13.200 9.240 N 4932414N04Rik n/a
5 TRCN0000441631 GACACAAGCAGGACGAGATTT pLKO_005 1948 CDS 100% 13.200 9.240 N 4932414N04Rik n/a
6 TRCN0000103929 CCACAATCTGAGCTGCATCAA pLKO.1 2396 CDS 100% 4.950 3.465 N 4932414N04Rik n/a
7 TRCN0000103927 CCTCGTGTAAAGCAGAACCAA pLKO.1 3144 CDS 100% 3.000 2.100 N 4932414N04Rik n/a
8 TRCN0000103928 CAAGACATGCAGCAAAGAAAT pLKO.1 1601 CDS 100% 13.200 7.920 N 4932414N04Rik n/a
9 TRCN0000103926 GCTATGGATGACCACCAGTTA pLKO.1 1268 CDS 100% 4.950 2.970 N 4932414N04Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.