Transcript: Mouse XM_006500336.1

PREDICTED: Mus musculus RIKEN cDNA 4932414N04 gene (4932414N04Rik), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4932414N04Rik (75721)
Length:
3497
CDS:
95..3340

Additional Resources:

NCBI RefSeq record:
XM_006500336.1
NBCI Gene record:
4932414N04Rik (75721)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432021 CCATAATGCCTCACGCATAAA pLKO_005 2932 CDS 100% 13.200 18.480 N 4932414N04Rik n/a
2 TRCN0000103925 GCCCGCAAATCAGTCCATAAT pLKO.1 2173 CDS 100% 13.200 18.480 N 4932414N04Rik n/a
3 TRCN0000428145 CAGTTACACTACCACTATTAG pLKO_005 3320 CDS 100% 13.200 10.560 N 4932414N04Rik n/a
4 TRCN0000422991 ATTATGATTTGCCTGATTATG pLKO_005 1176 CDS 100% 13.200 9.240 N 4932414N04Rik n/a
5 TRCN0000441631 GACACAAGCAGGACGAGATTT pLKO_005 1816 CDS 100% 13.200 9.240 N 4932414N04Rik n/a
6 TRCN0000103929 CCACAATCTGAGCTGCATCAA pLKO.1 2264 CDS 100% 4.950 3.465 N 4932414N04Rik n/a
7 TRCN0000103927 CCTCGTGTAAAGCAGAACCAA pLKO.1 3012 CDS 100% 3.000 2.100 N 4932414N04Rik n/a
8 TRCN0000103928 CAAGACATGCAGCAAAGAAAT pLKO.1 1469 CDS 100% 13.200 7.920 N 4932414N04Rik n/a
9 TRCN0000103926 GCTATGGATGACCACCAGTTA pLKO.1 1136 CDS 100% 4.950 2.970 N 4932414N04Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.