Transcript: Mouse XM_006500789.2

PREDICTED: Mus musculus protocadherin 18 (Pcdh18), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcdh18 (73173)
Length:
5242
CDS:
519..3926

Additional Resources:

NCBI RefSeq record:
XM_006500789.2
NBCI Gene record:
Pcdh18 (73173)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500789.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340666 GTTACTGCTTAGCATAGTTAA pLKO_005 4247 3UTR 100% 13.200 18.480 N Pcdh18 n/a
2 TRCN0000094263 CCATTGATACATTCGTTGCTA pLKO.1 1639 CDS 100% 3.000 4.200 N Pcdh18 n/a
3 TRCN0000340589 ATCGGTAATTGCTAGACTATC pLKO_005 641 CDS 100% 10.800 8.640 N Pcdh18 n/a
4 TRCN0000340587 CCGTTGTGCTGACCATCATTG pLKO_005 2200 CDS 100% 10.800 8.640 N Pcdh18 n/a
5 TRCN0000340586 TGCTGTGTTGCTGGTTATTAT pLKO_005 2648 CDS 100% 15.000 10.500 N Pcdh18 n/a
6 TRCN0000094260 GCACAATAATACTGCAGAAAT pLKO.1 2261 CDS 100% 13.200 9.240 N Pcdh18 n/a
7 TRCN0000094261 CCCGTCATTCCCATTGAGATA pLKO.1 936 CDS 100% 4.950 3.465 N Pcdh18 n/a
8 TRCN0000340588 ACCTTGCTCCTTGATCTAAAT pLKO_005 1305 CDS 100% 13.200 7.920 N Pcdh18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500789.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.