Transcript: Mouse XM_006500815.2

PREDICTED: Mus musculus cystathionase (cystathionine gamma-lyase) (Cth), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cth (107869)
Length:
1527
CDS:
48..956

Additional Resources:

NCBI RefSeq record:
XM_006500815.2
NBCI Gene record:
Cth (107869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500815.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431653 GTTAGTATCATTTCGGTAATT pLKO_005 1166 3UTR 100% 13.200 18.480 N Cth n/a
2 TRCN0000120090 CCTCAATAGTCGGCTTCGTTT pLKO.1 449 CDS 100% 4.950 6.930 N Cth n/a
3 TRCN0000420527 CACCTTCATGTCTGCATATTT pLKO_005 320 CDS 100% 15.000 10.500 N Cth n/a
4 TRCN0000445120 TGGCTCTGGGTGCTGATATTT pLKO_005 352 CDS 100% 15.000 10.500 N Cth n/a
5 TRCN0000432720 CATTGGAGCCTGCGCACAAAT pLKO_005 260 CDS 100% 13.200 9.240 N Cth n/a
6 TRCN0000431628 GAATAACTGGACAGATCATTA pLKO_005 1024 3UTR 100% 13.200 9.240 N Cth n/a
7 TRCN0000120089 CGGGATCAATGACACACTGAT pLKO.1 857 CDS 100% 4.950 3.465 N Cth n/a
8 TRCN0000120091 CACCACATTTAAGCAGGACTT pLKO.1 176 CDS 100% 4.050 2.835 N Cth n/a
9 TRCN0000120087 GCTATATTTGTGTCCAAGGAA pLKO.1 1189 3UTR 100% 3.000 2.100 N Cth n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500815.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.