Transcript: Mouse XM_006500970.1

PREDICTED: Mus musculus collagen, type XI, alpha 1 (Col11a1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Col11a1 (12814)
Length:
7220
CDS:
423..5720

Additional Resources:

NCBI RefSeq record:
XM_006500970.1
NBCI Gene record:
Col11a1 (12814)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377126 ACCAATGGAATCATGGTATTT pLKO_005 1017 CDS 100% 13.200 18.480 N Col11a1 n/a
2 TRCN0000366714 ATCTAACCGGAGAGGATTATG pLKO_005 1324 CDS 100% 13.200 18.480 N Col11a1 n/a
3 TRCN0000366647 CTGCCTGGTATGACGTATTAT pLKO_005 5452 CDS 100% 15.000 12.000 N Col11a1 n/a
4 TRCN0000091196 GCTGCCTGGTATGACGTATTA pLKO.1 5451 CDS 100% 13.200 10.560 N Col11a1 n/a
5 TRCN0000366646 GTGGACTGTGACGGCAATAAA pLKO_005 6178 3UTR 100% 15.000 10.500 N Col11a1 n/a
6 TRCN0000377125 ACATGCATCTATCCGGATAAA pLKO_005 5238 CDS 100% 13.200 9.240 N Col11a1 n/a
7 TRCN0000377060 ATCCATCAAAGATAGAGTAAA pLKO_005 6040 3UTR 100% 13.200 9.240 N Col11a1 n/a
8 TRCN0000366715 CTTCGATTTCTGGGATCAAAT pLKO_005 5493 CDS 100% 13.200 9.240 N Col11a1 n/a
9 TRCN0000091197 CCCTCGATAGAAGTGAGAGAT pLKO.1 985 CDS 100% 4.950 3.465 N Col11a1 n/a
10 TRCN0000091195 GCCTCAAGGTATCTCAGGAAA pLKO.1 3335 CDS 100% 4.950 3.465 N Col11a1 n/a
11 TRCN0000091194 CCTGGTTTAATTGGATTGATT pLKO.1 4662 CDS 100% 5.625 3.375 N Col11a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.