Transcript: Mouse XM_006500974.3

PREDICTED: Mus musculus cathepsin K (Ctsk), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ctsk (13038)
Length:
2047
CDS:
593..1582

Additional Resources:

NCBI RefSeq record:
XM_006500974.3
NBCI Gene record:
Ctsk (13038)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500974.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435836 GAAATCTCTCGGCGTTTAATT pLKO_005 719 CDS 100% 15.000 21.000 N CTSK n/a
2 TRCN0000054623 CCCTCTCGATCCTACAGTAAT pLKO.1 881 CDS 100% 13.200 18.480 N Ctsk n/a
3 TRCN0000329270 GACGCAGCGATGCTAACTAAG pLKO_005 1679 3UTR 100% 10.800 15.120 N Ctsk n/a
4 TRCN0000030590 CGACTATCGAAAGAAAGGATA pLKO.1 949 CDS 100% 4.950 6.930 N Ctsk n/a
5 TRCN0000030593 GACCGTGATAATGTGAACCAT pLKO.1 1400 CDS 100% 3.000 4.200 N Ctsk n/a
6 TRCN0000329338 TGAAATCTCTCGGCGTTTAAT pLKO_005 718 CDS 100% 15.000 12.000 N Ctsk n/a
7 TRCN0000030589 CGGCGTTTAATTTGGGAGAAA pLKO.1 728 CDS 100% 4.950 3.960 N Ctsk n/a
8 TRCN0000329339 AGCAAGCACTGGATAATTAAA pLKO_005 1457 CDS 100% 15.000 10.500 N Ctsk n/a
9 TRCN0000329268 CACGGCAAAGGCAGCTAAATG pLKO_005 1234 CDS 100% 13.200 9.240 N Ctsk n/a
10 TRCN0000329269 TGCTCTCTTGGCTCGGAATAA pLKO_005 1513 CDS 100% 13.200 9.240 N Ctsk n/a
11 TRCN0000030591 CCAGGATGAAAGTTGTATGTA pLKO.1 1207 CDS 100% 5.625 3.938 N Ctsk n/a
12 TRCN0000030592 CCTCTCTTGGTGTCCATACAT pLKO.1 783 CDS 100% 5.625 3.938 N Ctsk n/a
13 TRCN0000054627 GAGGGCCAACTCAAGAAGAAA pLKO.1 1037 CDS 100% 5.625 3.938 N Ctsk n/a
14 TRCN0000054626 GAGGTGTGTACTATGATGAAA pLKO.1 1374 CDS 100% 5.625 3.938 N Ctsk n/a
15 TRCN0000054625 GCCACGGCAAAGGCAGCTAAA pLKO.1 1232 CDS 100% 3.600 2.520 N Ctsk n/a
16 TRCN0000054624 CGGCTATATGACCACTGCCTT pLKO.1 1129 CDS 100% 2.640 1.848 N Ctsk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500974.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00397 pDONR223 100% 87.2% 86% None (many diffs) n/a
2 ccsbBroad304_00397 pLX_304 0% 87.2% 86% V5 (many diffs) n/a
3 TRCN0000481495 AAGAGTCACTTCTTTTTCTATATA pLX_317 44.1% 87.2% 86% V5 (many diffs) n/a
Download CSV