Transcript: Mouse XM_006501141.2

PREDICTED: Mus musculus ash1 (absent, small, or homeotic)-like (Drosophila) (Ash1l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ash1l (192195)
Length:
11353
CDS:
184..9060

Additional Resources:

NCBI RefSeq record:
XM_006501141.2
NBCI Gene record:
Ash1l (192195)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501141.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304509 AGCTACGTCAGAGACCTAAAC pLKO_005 9407 3UTR 100% 10.800 15.120 N Ash1l n/a
2 TRCN0000304510 CAGTCGAGATCCTGATATAAA pLKO_005 771 CDS 100% 15.000 12.000 N Ash1l n/a
3 TRCN0000082298 GCTGCCACATTTGGCTCTAAA pLKO.1 3253 CDS 100% 13.200 9.240 N Ash1l n/a
4 TRCN0000082299 CCTCCTACTTTGTTGCCAAAT pLKO.1 3664 CDS 100% 10.800 7.560 N Ash1l n/a
5 TRCN0000301835 CCTCCTACTTTGTTGCCAAAT pLKO_005 3664 CDS 100% 10.800 7.560 N Ash1l n/a
6 TRCN0000082300 CCCATTCATGTTGGAAAGTAT pLKO.1 6259 CDS 100% 5.625 3.938 N Ash1l n/a
7 TRCN0000082301 GCCTCACAGAAAGGAACCATT pLKO.1 5103 CDS 100% 4.950 3.465 N Ash1l n/a
8 TRCN0000331580 GCCTCACAGAAAGGAACCATT pLKO_005 5103 CDS 100% 4.950 3.465 N Ash1l n/a
9 TRCN0000082302 GCTGGTCATTTATTGCTCAAT pLKO.1 4462 CDS 100% 4.950 3.465 N Ash1l n/a
10 TRCN0000301836 GCTGGTCATTTATTGCTCAAT pLKO_005 4462 CDS 100% 4.950 3.465 N Ash1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501141.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.