Transcript: Mouse XM_006501338.3

PREDICTED: Mus musculus ribosomal RNA adenine dimethylase domain containing 1 (Rrnad1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rrnad1 (229503)
Length:
1549
CDS:
16..1416

Additional Resources:

NCBI RefSeq record:
XM_006501338.3
NBCI Gene record:
Rrnad1 (229503)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501338.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336018 TATGCGGAGAGATTACATAAA pLKO_005 961 CDS 100% 13.200 18.480 N Rrnad1 n/a
2 TRCN0000336080 GGATACCATAACTTCAGATTT pLKO_005 1447 3UTR 100% 13.200 10.560 N Rrnad1 n/a
3 TRCN0000173738 CCTGAACTCTCTCCCAGAAAT pLKO.1 1327 CDS 100% 13.200 9.240 N Rrnad1 n/a
4 TRCN0000336016 CCTGAACTCTCTCCCAGAAAT pLKO_005 1327 CDS 100% 13.200 9.240 N Rrnad1 n/a
5 TRCN0000173368 GAGGACTATGCGGAGAGATTA pLKO.1 955 CDS 100% 13.200 9.240 N Rrnad1 n/a
6 TRCN0000336017 TATGTGAAACAAGGGTTAAAG pLKO_005 1111 CDS 100% 13.200 9.240 N Rrnad1 n/a
7 TRCN0000194173 GAAACATGTCAAGCCCAAGAA pLKO.1 369 CDS 100% 4.950 3.465 N Rrnad1 n/a
8 TRCN0000173462 GCTGCTGCTACATGAAACTCA pLKO.1 839 CDS 100% 3.000 2.100 N Rrnad1 n/a
9 TRCN0000336078 GCTGCTGCTACATGAAACTCA pLKO_005 839 CDS 100% 3.000 2.100 N Rrnad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501338.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.