Transcript: Mouse XM_006501353.1

PREDICTED: Mus musculus pre B cell leukemia transcription factor interacting protein 1 (Pbxip1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pbxip1 (229534)
Length:
4590
CDS:
229..2412

Additional Resources:

NCBI RefSeq record:
XM_006501353.1
NBCI Gene record:
Pbxip1 (229534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081952 CGGACGAATCTGGGAGCAGAA pLKO.1 1799 CDS 100% 1.350 1.080 N Pbxip1 n/a
2 TRCN0000081948 GCTCAAGATGCCTGGAGTTAT pLKO.1 2453 3UTR 100% 13.200 9.240 N Pbxip1 n/a
3 TRCN0000422289 AGATCCATCCACAGAACTTAC pLKO_005 593 CDS 100% 10.800 7.560 N Pbxip1 n/a
4 TRCN0000417570 ATAAAGGCCCTGGGTACTAAG pLKO_005 2678 3UTR 100% 10.800 7.560 N Pbxip1 n/a
5 TRCN0000421436 ATGATGAAGTGGATGACTTTG pLKO_005 2249 CDS 100% 10.800 7.560 N Pbxip1 n/a
6 TRCN0000081950 CCAGCTTATTGGAGCAGCATA pLKO.1 1361 CDS 100% 4.950 3.465 N Pbxip1 n/a
7 TRCN0000081949 CCTGAAGAAGAGGTCACGAAA pLKO.1 2307 CDS 100% 4.950 3.465 N Pbxip1 n/a
8 TRCN0000081951 CCTGCTTACTTTGGAGAAGAT pLKO.1 2134 CDS 100% 4.950 3.465 N Pbxip1 n/a
9 TRCN0000015075 GCTGGGCATCTCCCTCAACAT pLKO.1 786 CDS 100% 1.650 1.155 N PBXIP1 n/a
10 TRCN0000413379 AGGATGGCAAGGCCACTAAAG pLKO_005 1310 CDS 100% 10.800 6.480 N Pbxip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.