Transcript: Mouse XM_006501380.1

PREDICTED: Mus musculus cDNA sequence BC028528 (BC028528), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
BC028528 (229600)
Length:
545
CDS:
58..474

Additional Resources:

NCBI RefSeq record:
XM_006501380.1
NBCI Gene record:
BC028528 (229600)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177048 GAAGAGGGTGATTACTATCAA pLKO.1 133 CDS 100% 5.625 7.875 N BC028528 n/a
2 TRCN0000177484 GATAGGTTGAACAGGTTGAAT pLKO.1 241 CDS 100% 5.625 7.875 N BC028528 n/a
3 TRCN0000197405 CCTAATTATGATGACTTCAGT pLKO.1 181 CDS 100% 3.000 4.200 N BC028528 n/a
4 TRCN0000198337 GTTTGAGTCAGAGGATAGGTT pLKO.1 228 CDS 100% 3.000 2.400 N BC028528 n/a
5 TRCN0000215369 CAGTCTTCATACAGAACTTAT pLKO.1 309 CDS 100% 13.200 9.240 N BC028528 n/a
6 TRCN0000437799 GAGACTACAGCCTCTTCATAC pLKO_005 289 CDS 100% 10.800 7.560 N BC028528 n/a
7 TRCN0000177072 GATTACTATCAAGTGGCATAT pLKO.1 142 CDS 100% 10.800 7.560 N BC028528 n/a
8 TRCN0000414081 AGAATCCTGTAACCACGAAAC pLKO_005 338 CDS 100% 6.000 4.200 N BC028528 n/a
9 TRCN0000197406 CAAATCAGAATGATGCCATGT pLKO.1 383 CDS 100% 4.050 2.835 N BC028528 n/a
10 TRCN0000413737 CCCTAATTATGATGACTTCAG pLKO_005 180 CDS 100% 4.050 2.835 N BC028528 n/a
11 TRCN0000197443 CAGTGTAAACTTCACTGTTGA pLKO.1 198 CDS 100% 0.495 0.347 N BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.