Transcript: Mouse XM_006501385.3

PREDICTED: Mus musculus OTU domain containing 7B (Otud7b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Otud7b (229603)
Length:
8173
CDS:
490..3012

Additional Resources:

NCBI RefSeq record:
XM_006501385.3
NBCI Gene record:
Otud7b (229603)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305141 TGTCCGATTGGCCAGTATAAT pLKO_005 1713 CDS 100% 15.000 21.000 N Otud7b n/a
2 TRCN0000311256 GGTAGATATTAGGGTTGAATA pLKO_005 3477 3UTR 100% 13.200 18.480 N Otud7b n/a
3 TRCN0000030956 CCTTTAGTGGAGGGAGTACTT pLKO.1 653 CDS 100% 4.950 3.960 N Otud7b n/a
4 TRCN0000308626 CCTTTAGTGGAGGGAGTACTT pLKO_005 653 CDS 100% 4.950 3.960 N Otud7b n/a
5 TRCN0000305077 CTGAATTGGTGGGTTAGTATG pLKO_005 997 CDS 100% 10.800 7.560 N Otud7b n/a
6 TRCN0000030957 ACCTTGCAGATGCTGAGGAAA pLKO.1 2384 CDS 100% 4.950 3.465 N Otud7b n/a
7 TRCN0000030958 GCATAGCTATATGAATGTGAA pLKO.1 1764 CDS 100% 4.950 3.465 N Otud7b n/a
8 TRCN0000030954 GAGCACTATGAGGATCGCAAT pLKO.1 2280 CDS 100% 4.050 2.835 N Otud7b n/a
9 TRCN0000030955 GCAGAAGGAATGGAATGAATT pLKO.1 1251 CDS 100% 0.000 0.000 N Otud7b n/a
10 TRCN0000308627 GCAGAAGGAATGGAATGAATT pLKO_005 1251 CDS 100% 0.000 0.000 N Otud7b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.