Transcript: Mouse XM_006501386.3

PREDICTED: Mus musculus OTU domain containing 7B (Otud7b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Otud7b (229603)
Length:
8231
CDS:
548..3070

Additional Resources:

NCBI RefSeq record:
XM_006501386.3
NBCI Gene record:
Otud7b (229603)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501386.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305141 TGTCCGATTGGCCAGTATAAT pLKO_005 1771 CDS 100% 15.000 21.000 N Otud7b n/a
2 TRCN0000311256 GGTAGATATTAGGGTTGAATA pLKO_005 3535 3UTR 100% 13.200 18.480 N Otud7b n/a
3 TRCN0000030956 CCTTTAGTGGAGGGAGTACTT pLKO.1 711 CDS 100% 4.950 3.960 N Otud7b n/a
4 TRCN0000308626 CCTTTAGTGGAGGGAGTACTT pLKO_005 711 CDS 100% 4.950 3.960 N Otud7b n/a
5 TRCN0000305077 CTGAATTGGTGGGTTAGTATG pLKO_005 1055 CDS 100% 10.800 7.560 N Otud7b n/a
6 TRCN0000030957 ACCTTGCAGATGCTGAGGAAA pLKO.1 2442 CDS 100% 4.950 3.465 N Otud7b n/a
7 TRCN0000030958 GCATAGCTATATGAATGTGAA pLKO.1 1822 CDS 100% 4.950 3.465 N Otud7b n/a
8 TRCN0000030954 GAGCACTATGAGGATCGCAAT pLKO.1 2338 CDS 100% 4.050 2.835 N Otud7b n/a
9 TRCN0000030955 GCAGAAGGAATGGAATGAATT pLKO.1 1309 CDS 100% 0.000 0.000 N Otud7b n/a
10 TRCN0000308627 GCAGAAGGAATGGAATGAATT pLKO_005 1309 CDS 100% 0.000 0.000 N Otud7b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501386.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.