Transcript: Mouse XM_006501971.4

PREDICTED: Mus musculus glutathione S-transferase, mu 7 (Gstm7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Gstm7 (68312)
Length:
1268
CDS:
34..711

Additional Resources:

NCBI RefSeq record:
XM_006501971.4
NBCI Gene record:
Gstm7 (68312)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501971.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267455 CAGGGTGGGCTGTAGGATAAA pLKO_005 720 3UTR 100% 13.200 9.240 N Gstm7 n/a
2 TRCN0000252917 CCAAGACCCATGTTCACAAAG pLKO_005 667 CDS 100% 10.800 7.560 N Gstm7 n/a
3 TRCN0000252918 CCCTGGAATGATGAGGCTTTA pLKO_005 447 CDS 100% 10.800 7.560 N Gstm7 n/a
4 TRCN0000252916 TATTCTGGAGAATCAGCTTAT pLKO_005 348 CDS 100% 10.800 7.560 N Gstm7 n/a
5 TRCN0000252919 AGATCACCTTTGTGGATTTCA pLKO_005 509 CDS 100% 5.625 3.938 N Gstm7 n/a
6 TRCN0000147236 GAATACACAGACTCAAGCTAT pLKO.1 118 CDS 100% 4.950 2.475 Y GSTM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501971.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.