Transcript: Mouse XM_006502047.3

PREDICTED: Mus musculus structural maintenance of chromosomes 4 (Smc4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smc4 (70099)
Length:
4089
CDS:
342..3992

Additional Resources:

NCBI RefSeq record:
XM_006502047.3
NBCI Gene record:
Smc4 (70099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502047.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275730 ACGGCTAAATGAACCTATTAA pLKO_005 908 CDS 100% 15.000 21.000 N SMC4 n/a
2 TRCN0000108944 GCAGAATAGAATTGCTGAAAT pLKO.1 1115 CDS 100% 13.200 18.480 N Smc4 n/a
3 TRCN0000375572 GCTATCGGTACTGATACATAA pLKO_005 548 CDS 100% 13.200 18.480 N Smc4 n/a
4 TRCN0000366681 TCGGTTATTTGATCTAGTTAA pLKO_005 2198 CDS 100% 13.200 18.480 N Smc4 n/a
5 TRCN0000108940 CGGCTAAATGAACCTATTAAA pLKO.1 909 CDS 100% 15.000 10.500 N Smc4 n/a
6 TRCN0000366750 GAAGGTATGCTTGAGTATTTA pLKO_005 867 CDS 100% 15.000 10.500 N Smc4 n/a
7 TRCN0000375571 ATACCTTGGTGGCTAACAATT pLKO_005 2266 CDS 100% 13.200 9.240 N Smc4 n/a
8 TRCN0000379265 GGCATTGACTTAGACCATAAT pLKO_005 774 CDS 100% 13.200 9.240 N Smc4 n/a
9 TRCN0000366749 TCGTCTCATGATAACTCATAT pLKO_005 365 CDS 100% 13.200 9.240 N Smc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502047.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.