Transcript: Mouse XM_006502060.1

PREDICTED: Mus musculus transmembrane protein 144 (Tmem144), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem144 (70652)
Length:
2214
CDS:
152..715

Additional Resources:

NCBI RefSeq record:
XM_006502060.1
NBCI Gene record:
Tmem144 (70652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366467 ATACTCTACGGATCGACATTT pLKO_005 269 CDS 100% 13.200 18.480 N Tmem144 n/a
2 TRCN0000181395 CCTTGCGGTAATATCTGGAAT pLKO.1 250 CDS 100% 4.950 6.930 N Tmem144 n/a
3 TRCN0000216605 GAAATTACCATCCCAATTTAT pLKO.1 1048 3UTR 100% 1.500 2.100 N Tmem144 n/a
4 TRCN0000366465 TCTGGGAATGAACGGATAAAT pLKO_005 834 3UTR 100% 15.000 12.000 N Tmem144 n/a
5 TRCN0000366464 AGGCGCTAGCCAGTATGATTT pLKO_005 343 CDS 100% 13.200 9.240 N Tmem144 n/a
6 TRCN0000375189 CATCGCCAACCACTCACTAAG pLKO_005 526 CDS 100% 10.800 7.560 N Tmem144 n/a
7 TRCN0000375256 GGATCATCCTGTCTAACAATG pLKO_005 980 3UTR 100% 10.800 7.560 N Tmem144 n/a
8 TRCN0000198809 CGGATCATCCTGTCTAACAAT pLKO.1 979 3UTR 100% 5.625 3.938 N Tmem144 n/a
9 TRCN0000198848 CTCGCTTTCTGCATCATCTTA pLKO.1 659 CDS 100% 5.625 3.938 N Tmem144 n/a
10 TRCN0000182580 GCCTTGCGGTAATATCTGGAA pLKO.1 249 CDS 100% 2.640 1.848 N Tmem144 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.