Transcript: Mouse XM_006502238.3

PREDICTED: Mus musculus gon-4-like (C.elegans) (Gon4l), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gon4l (76022)
Length:
7560
CDS:
63..6848

Additional Resources:

NCBI RefSeq record:
XM_006502238.3
NBCI Gene record:
Gon4l (76022)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240877 TGGAATATTTCACCAATTAAG pLKO_005 1092 CDS 100% 13.200 9.240 N GON4L n/a
2 TRCN0000234264 CAGAACCCTGAGTCCAAATTA pLKO_005 3807 CDS 100% 15.000 7.500 Y Gon4l n/a
3 TRCN0000234265 AGCTCTTCATCGAAGGATTTA pLKO_005 4077 CDS 100% 13.200 6.600 Y Gon4l n/a
4 TRCN0000234263 AGGATGAACTGCGGAACATAT pLKO_005 2872 CDS 100% 13.200 6.600 Y Gon4l n/a
5 TRCN0000234262 CCGGCTTCCATTCTGGTTAAA pLKO_005 2831 CDS 100% 13.200 6.600 Y Gon4l n/a
6 TRCN0000240084 TTCCTGTACATGTGGATAAAG pLKO_005 403 CDS 100% 13.200 6.600 Y LOC677582 n/a
7 TRCN0000240086 CTCCTTGGAGTCTTCTCATTC pLKO_005 380 CDS 100% 10.800 5.400 Y LOC677582 n/a
8 TRCN0000240087 TGGCCCAGCATGTGAACTTAG pLKO_005 310 CDS 100% 10.800 5.400 Y LOC677582 n/a
9 TRCN0000240085 AGTCTTGGAAGCCGTTGATGT pLKO_005 332 CDS 100% 4.950 2.475 Y LOC677582 n/a
10 TRCN0000240088 GCTGTCTTTGAACTCGAAGAT pLKO_005 287 CDS 100% 4.950 2.475 Y LOC677582 n/a
11 TRCN0000180912 GCAAGGTCTGTGACAGCAAAT pLKO.1 5758 CDS 100% 10.800 7.560 N GON4L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.