Transcript: Mouse XM_006502285.3

PREDICTED: Mus musculus collagen, type XXV, alpha 1 (Col25a1), transcript variant X23, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Col25a1 (77018)
Length:
7334
CDS:
1145..3142

Additional Resources:

NCBI RefSeq record:
XM_006502285.3
NBCI Gene record:
Col25a1 (77018)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502285.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089715 GCTCAGAAATCCTACGAACAT pLKO.1 1436 CDS 100% 4.950 6.930 N Col25a1 n/a
2 TRCN0000428828 GCTGATCAGCAGCTCATTAAA pLKO_005 1673 CDS 100% 15.000 10.500 N COL25A1 n/a
3 TRCN0000089714 GCTGCTCTTGAATCTGCTAAA pLKO.1 1334 CDS 100% 10.800 7.560 N Col25a1 n/a
4 TRCN0000089717 GATGGAGAACAGGGACTCAAA pLKO.1 2567 CDS 100% 4.950 3.465 N Col25a1 n/a
5 TRCN0000116383 GCTGCAGGAATTAAGGGAGAA pLKO.1 2069 CDS 100% 4.050 2.835 N COL25A1 n/a
6 TRCN0000089716 GCAGGAATTAAGGGAGAACCT pLKO.1 2072 CDS 100% 2.640 1.848 N Col25a1 n/a
7 TRCN0000089713 CCTGGGTTGATCCATACCAAA pLKO.1 3664 3UTR 100% 4.950 2.970 N Col25a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502285.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.