Transcript: Mouse XM_006502291.3

PREDICTED: Mus musculus B cell CLL/lymphoma 9 (Bcl9), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcl9 (77578)
Length:
6140
CDS:
697..4938

Additional Resources:

NCBI RefSeq record:
XM_006502291.3
NBCI Gene record:
Bcl9 (77578)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314152 GCGGAAGCCTTTGGATATATC pLKO_005 3219 CDS 100% 13.200 18.480 N Bcl9 n/a
2 TRCN0000314207 TTTGATCTCTCCCGCATTATC pLKO_005 4357 CDS 100% 13.200 18.480 N Bcl9 n/a
3 TRCN0000109299 CTCCATTATGATGTCTCGAAT pLKO.1 3711 CDS 100% 4.950 6.930 N Bcl9 n/a
4 TRCN0000109296 GCGCAATCTCAGAGAACCAAT pLKO.1 3084 CDS 100% 4.950 3.960 N Bcl9 n/a
5 TRCN0000317945 GCGCAATCTCAGAGAACCAAT pLKO_005 3084 CDS 100% 4.950 3.960 N Bcl9 n/a
6 TRCN0000314208 TTCTACGGAGATGGCAAATAA pLKO_005 1236 CDS 100% 15.000 10.500 N Bcl9 n/a
7 TRCN0000314150 ATCCTTGTCAAGATGAGATTC pLKO_005 4961 3UTR 100% 10.800 7.560 N Bcl9 n/a
8 TRCN0000109295 CCTTACTGTTGGTCATGCAAT pLKO.1 5019 3UTR 100% 4.950 3.465 N Bcl9 n/a
9 TRCN0000109297 CCATGATGTCTCAATCCCAAA pLKO.1 1919 CDS 100% 4.050 2.835 N Bcl9 n/a
10 TRCN0000109298 CCAGAACATCTCTAACAGCAA pLKO.1 1311 CDS 100% 2.640 1.848 N Bcl9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.