Transcript: Mouse XM_006502699.2

PREDICTED: Mus musculus InaD-like (Drosophila) (Inadl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Patj (12695)
Length:
7444
CDS:
273..5777

Additional Resources:

NCBI RefSeq record:
XM_006502699.2
NBCI Gene record:
Patj (12695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429907 AGATCGGATTGTGAGCATTAA pLKO_005 5543 CDS 100% 13.200 18.480 N Patj n/a
2 TRCN0000417221 GAACAGTTGCCTCGGCTAAAG pLKO_005 5965 3UTR 100% 10.800 15.120 N Patj n/a
3 TRCN0000124701 GCCGTTAATCTACTGAAGAAT pLKO.1 5598 CDS 100% 5.625 7.875 N Patj n/a
4 TRCN0000124702 GCCGGGAGAACTACACATTAT pLKO.1 3989 CDS 100% 13.200 10.560 N Patj n/a
5 TRCN0000419720 TGTCATCTTAACTCGTGATTT pLKO_005 6127 3UTR 100% 13.200 10.560 N Patj n/a
6 TRCN0000124700 CCCATATTTATTGCCATGATT pLKO.1 5478 CDS 100% 5.625 3.938 N Patj n/a
7 TRCN0000124699 CCTCGCAATGAACTATTCATA pLKO.1 6206 3UTR 100% 5.625 3.938 N Patj n/a
8 TRCN0000124703 CCATTGTGTCAGTCAGCACAT pLKO.1 4560 CDS 100% 4.050 2.835 N Patj n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.