Transcript: Mouse XM_006502722.3

PREDICTED: Mus musculus cytochrome P450, family 2, subfamily j, polypeptide 6 (Cyp2j6), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyp2j6 (13110)
Length:
3848
CDS:
1162..1959

Additional Resources:

NCBI RefSeq record:
XM_006502722.3
NBCI Gene record:
Cyp2j6 (13110)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174909 GCAATGGATACCAATTTGAAT pLKO.1 1603 CDS 100% 5.625 7.875 N Cyp2j6 n/a
2 TRCN0000173360 GCCTGAATCTTGGTGACATAA pLKO.1 571 5UTR 100% 13.200 10.560 N Cyp2j6 n/a
3 TRCN0000193703 CCTCTAAGTGTTATGCAAGAA pLKO.1 666 5UTR 100% 4.950 3.960 N Cyp2j6 n/a
4 TRCN0000174311 CACTTACTCAAATGGAACAAA pLKO.1 631 5UTR 100% 5.625 3.938 N Cyp2j6 n/a
5 TRCN0000175427 CCCTTAATCAAAGAAGCACTT pLKO.1 615 5UTR 100% 4.050 2.835 N Cyp2j6 n/a
6 TRCN0000193189 CAATGGTTCTAACAAACCTAA pLKO.1 1646 CDS 100% 4.950 2.970 N Cyp2j6 n/a
7 TRCN0000216311 GTACCCATACCATCAAGTATA pLKO.1 3099 3UTR 100% 0.000 0.000 N Cyp2j6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.