Transcript: Mouse XM_006502894.1

PREDICTED: Mus musculus ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (St3gal3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St3gal3 (20441)
Length:
2227
CDS:
124..1332

Additional Resources:

NCBI RefSeq record:
XM_006502894.1
NBCI Gene record:
St3gal3 (20441)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018836 CGGATTGACGACTATGACATT pLKO.1 649 CDS 100% 4.950 6.930 N St3gal3 n/a
2 TRCN0000018835 GCACGTGTCATCACTGACTTA pLKO.1 1297 CDS 100% 4.950 6.930 N St3gal3 n/a
3 TRCN0000277418 ATGCAGCGACCTGAGCAATAT pLKO_005 760 CDS 100% 13.200 10.560 N St3gal3 n/a
4 TRCN0000018833 CGCTGCATCATTGTAGGCAAT pLKO.1 595 CDS 100% 4.050 3.240 N St3gal3 n/a
5 TRCN0000277416 CTCCTGAAGCTGGACTCTAAA pLKO_005 307 CDS 100% 13.200 9.240 N St3gal3 n/a
6 TRCN0000232801 GTGTTTGGTGTATTATCATTT pLKO_005 1630 3UTR 100% 13.200 9.240 N ST3GAL3 n/a
7 TRCN0000277455 GTGTTTGGTGTATTATCATTT pLKO_005 1630 3UTR 100% 13.200 9.240 N St3gal3 n/a
8 TRCN0000035716 GCCATCTTGTCAGTCACCAAA pLKO.1 532 CDS 100% 4.950 3.465 N ST3GAL3 n/a
9 TRCN0000018834 GCTGAAGTACATCGTCTACAA pLKO.1 834 CDS 100% 4.950 3.465 N St3gal3 n/a
10 TRCN0000277417 GCTGAAGTACATCGTCTACAA pLKO_005 834 CDS 100% 4.950 3.465 N St3gal3 n/a
11 TRCN0000018832 GCCACCAAGTACGCAAACTTT pLKO.1 343 CDS 100% 5.625 3.375 N St3gal3 n/a
12 TRCN0000277466 GCCACCAAGTACGCAAACTTT pLKO_005 343 CDS 100% 5.625 3.375 N St3gal3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01534 pDONR223 100% 85.5% 90.3% None (many diffs) n/a
2 ccsbBroad304_01534 pLX_304 0% 85.5% 90.3% V5 (many diffs) n/a
3 TRCN0000492269 CGTGAGCGCATCGCAAAACCGGGC pLX_317 35.8% 85.5% 90.3% V5 (many diffs) n/a
Download CSV