Transcript: Mouse XM_006503308.3

PREDICTED: Mus musculus dedicator of cytokinesis 7 (Dock7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dock7 (67299)
Length:
7863
CDS:
1026..7454

Additional Resources:

NCBI RefSeq record:
XM_006503308.3
NBCI Gene record:
Dock7 (67299)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215569 GATCCAAACAAGGCATATATT pLKO.1 6744 CDS 100% 15.000 21.000 N Dock7 n/a
2 TRCN0000244525 ACGGGACGCTTACCAACTAAA pLKO_005 3948 CDS 100% 13.200 18.480 N Dock7 n/a
3 TRCN0000376636 ACGGGACGCTTACCAACTAAA pLKO_005 3948 CDS 100% 13.200 18.480 N DOCK7 n/a
4 TRCN0000244527 GGTAACATGCTGTCATCTTAA pLKO_005 7636 3UTR 100% 13.200 10.560 N Dock7 n/a
5 TRCN0000244526 CCTACCTCTTATTGGTATTAT pLKO_005 4784 CDS 100% 15.000 10.500 N Dock7 n/a
6 TRCN0000244528 GCGGATGTTTGGCACCTATTT pLKO_005 6539 CDS 100% 13.200 9.240 N Dock7 n/a
7 TRCN0000191485 GATGTCATTCTGGAAGCAATA pLKO.1 7534 3UTR 100% 10.800 7.560 N Dock7 n/a
8 TRCN0000217351 GCAACAGTAACCCAGATATAT pLKO.1 3718 CDS 100% 15.000 9.000 N Dock7 n/a
9 TRCN0000200829 GCCTTTGTTTCAAGGACTTTA pLKO.1 7216 CDS 100% 13.200 7.920 N Dock7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.