Transcript: Mouse XM_006503426.2

PREDICTED: Mus musculus heat shock protein family B (small), member 11 (Hspb11), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hspb11 (72938)
Length:
678
CDS:
146..577

Additional Resources:

NCBI RefSeq record:
XM_006503426.2
NBCI Gene record:
Hspb11 (72938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252135 AGTTACTTGGTGCGGACTTTG pLKO_005 341 CDS 100% 10.800 15.120 N Hspb11 n/a
2 TRCN0000252131 TTCACAAACACGTAAAGATTG pLKO_005 303 CDS 100% 10.800 8.640 N Hspb11 n/a
3 TRCN0000252134 CTGAAGGGACAGAAGTGATTC pLKO_005 174 CDS 100% 10.800 7.560 N Hspb11 n/a
4 TRCN0000252132 CATTGATGGGAATCCGGAAAC pLKO_005 235 CDS 100% 6.000 4.200 N Hspb11 n/a
5 TRCN0000252133 TGGACCACCACAGGCATGTTT pLKO_005 260 CDS 100% 5.625 3.938 N Hspb11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08336 pDONR223 100% 86.8% 84% None (many diffs) n/a
2 ccsbBroad304_08336 pLX_304 0% 86.8% 84% V5 (many diffs) n/a
3 TRCN0000471953 CAGTGCCAATTCCCTCCAACCACC pLX_317 92% 86.8% 84% V5 (many diffs) n/a
Download CSV