Transcript: Mouse XM_006503610.3

PREDICTED: Mus musculus carnitine O-octanoyltransferase (Crot), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Crot (74114)
Length:
3876
CDS:
1435..3057

Additional Resources:

NCBI RefSeq record:
XM_006503610.3
NBCI Gene record:
Crot (74114)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503610.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110569 CGATGCAATGGTCATGGTGAA pLKO.1 2208 CDS 100% 4.050 5.670 N Crot n/a
2 TRCN0000325522 CGATGCAATGGTCATGGTGAA pLKO_005 2208 CDS 100% 4.050 5.670 N Crot n/a
3 TRCN0000110565 GCCTCAACAAAGCAAATCTAT pLKO.1 3261 3UTR 100% 5.625 3.938 N Crot n/a
4 TRCN0000325525 GCCTCAACAAAGCAAATCTAT pLKO_005 3261 3UTR 100% 5.625 3.938 N Crot n/a
5 TRCN0000110568 CCACGATATGATACAGCTGAT pLKO.1 3018 CDS 100% 4.050 2.835 N Crot n/a
6 TRCN0000325524 CCACGATATGATACAGCTGAT pLKO_005 3018 CDS 100% 4.050 2.835 N Crot n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1553 CDS 100% 4.950 2.475 Y KAAG1 n/a
8 TRCN0000079943 CCTGCTTTCTTATAGAACCAA pLKO.1 957 5UTR 100% 3.000 1.500 Y Spint1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503610.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.