Transcript: Mouse XM_006503778.3

PREDICTED: Mus musculus peroxisome proliferative activated receptor, gamma, coactivator 1 alpha (Ppargc1a), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppargc1a (19017)
Length:
6655
CDS:
376..2724

Additional Resources:

NCBI RefSeq record:
XM_006503778.3
NBCI Gene record:
Ppargc1a (19017)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503778.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095309 CCAGAACAAGAACAACGGTTT pLKO.1 2908 3UTR 100% 4.050 3.240 N Ppargc1a n/a
2 TRCN0000001167 CCTCCTCATAAAGCCAACCAA pLKO.1 1225 CDS 100% 3.000 2.400 N PPARGC1A n/a
3 TRCN0000234017 TCCAGTAAGCACACGTTTATT pLKO_005 2971 3UTR 100% 15.000 10.500 N Ppargc1a n/a
4 TRCN0000234016 CTAGCCATGGATGGCCTATTT pLKO_005 1840 CDS 100% 13.200 9.240 N Ppargc1a n/a
5 TRCN0000218958 AGACTATTGAGCGAACCTTAA pLKO_005 1160 CDS 100% 10.800 7.560 N Ppargc1a n/a
6 TRCN0000364086 TCGTGTTCCCGATCACCATAT pLKO_005 2056 CDS 100% 10.800 7.560 N PPARGC1A n/a
7 TRCN0000095313 CCCATTTGAGAACAAGACTAT pLKO.1 1146 CDS 100% 4.950 3.465 N Ppargc1a n/a
8 TRCN0000095311 GCCATTGTTAAGACCGAGAAT pLKO.1 868 CDS 100% 4.950 3.465 N Ppargc1a n/a
9 TRCN0000095310 CGTGTGATTTACGTTGGTAAA pLKO.1 2356 CDS 100% 1.080 0.756 N Ppargc1a n/a
10 TRCN0000219080 TAACTATGCAGACCTAGATAC pLKO_005 2604 CDS 100% 10.800 6.480 N Ppargc1a n/a
11 TRCN0000095312 GCGACTTCAGTAATGAACAAT pLKO.1 1787 CDS 100% 5.625 3.375 N Ppargc1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503778.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.