Transcript: Mouse XM_006503807.1

PREDICTED: Mus musculus solute carrier family 34 (sodium phosphate), member 2 (Slc34a2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc34a2 (20531)
Length:
4325
CDS:
78..2291

Additional Resources:

NCBI RefSeq record:
XM_006503807.1
NBCI Gene record:
Slc34a2 (20531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503807.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069543 GCTTCTTCATTGCTGACGGTT pLKO.1 711 CDS 100% 2.640 3.696 N Slc34a2 n/a
2 TRCN0000422155 GCAACATCTCTGCCAAGTATC pLKO_005 1753 CDS 100% 10.800 7.560 N SLC34A2 n/a
3 TRCN0000069544 CCCAGACATTCTGAAAGTCAT pLKO.1 977 CDS 100% 4.950 3.465 N Slc34a2 n/a
4 TRCN0000069547 CCTGATCAAGATCTGGTGTAA pLKO.1 1088 CDS 100% 4.950 3.465 N Slc34a2 n/a
5 TRCN0000069545 CGCAGTCTTCTATCTCATCTT pLKO.1 1781 CDS 100% 4.950 3.465 N Slc34a2 n/a
6 TRCN0000069546 CGGACAGTTCTTCAGCAACAA pLKO.1 587 CDS 100% 4.950 3.465 N Slc34a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503807.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.